Building block of genome

Building block of genome : 
Considering the above properties of genetic material, two macromolecules, DNA and protein were strong contenders for qualifying as genetic material, and long debate existed in the first half of twentieth century supporting each of these two polymeric molecules. Both were long molecules, composed of multiple of
monomeric units, abundant in cell fulfilling the primary criteria of genetic material. The fact that genetic information contained in the genome is coded in a long polynucleotide chain known as deoxyribonucleic acid or DNA was elucidated by a number of observations. In 1928, F. Griffith discovered that a transforming
principle present in dead IJipiococcus pneu maniac ceLls can convert nonvirulent strains into virulent ones and live virulent strains with altered genotype can be recovered from infected mouse. Following the lead Avery, MacLeod and McCarty established in 1944 that the transforming principle that converts nonvirulent strains to virulent types is DNA. In a series of experiments they showed that if the mixture of heat killed cells of virulent strain and live nonvirulent strain are treated with enzyme that degrade DNA, transformation
is not observed. However, when treated with protein degrading enzymes, transformation was not hampered suggesting DNA, not protein is the genetic material. Finally in 1952 Alfred Harshey and Martha chase labeled proteins with radioactive S and DNA with P in bacteriophage T2, infected E. coil with the labeled phages and observed that when DNA was labeled, radioactivity was observed inside the host cell while proteins were labeled,radioactivity was found outside host. The fact that proteins contain sulfur but no phosphorus, and DNA contains phosphorus but no sulfur along with the observations proved beyond doubt that the viral genome that infects E. coil consists of DNA.
        The fascinating journey of discoveries that elucidated the structure of the most important biological molecule started in the hand of F. Miescher in Germany in 1869, who isolated an acidic substance different from protein in the nucleus of pus cell and named it as ‘Nuclein’. The substance was later named as nucleic
acid by R. Altmann. Basic unit of the substance was discovered to be a nucleotide consisting of a ribose sugar joined to a nitrogenous base and a phosphate group. The nucleotides are connected to each other by a pisospliodiester bridge to develop a long polynucleotide chain. Each base is linked to the 1’ carbon of the
sugar moiety by glycosidic bond. Chemically, there are four types of nucleotides in DNA which vary from each other due to change in the nitrogenous base structure. Four types of nitrogenous bases,
Adenine, Guanine, Cytosine and Thymine are present in DNA that are sequentially arranged on 2’-deoxyribose sugar of every nucleotide. It is the sequence of these bases present in DNA that
make up the genetic information of the organism. Two of these bases, Adenine and Guanine are derivatives of purine, while Cytosine and Thymine, as well as Uracil present in RNA are derivatives of pyrimidine bases. Primary composition of DNA and RNA are essentially same, however in RNA in place of deoxyribose, ribose sugar is present and pyrimidine base Uracil is present in place of Thymine. Presence of a 2’-hydroxy group in RNA makes it more reactive and less stable than DNA, which is one of the major reasons of replacing RNA by DNA as genetic material in the course of evolution. The chain of DNA or RNA can be
extended by joining 5’-carbon of the ribose/deoxyribose sugar of nucleotide to the 3’-phosphate group of the existing chain, so that DNA/RNA chain grows only in the direction of 5’-+3”. Each of the polynucleotide chain is, therefore has a polarity as well as a net negative charge due to presence of phosphate groups.Conventional norm of representing a DNA or RNA molecule is by the base sequence present in the chain along with the direction of polarity, such as 5’AATGCGAGTCCAGGTCCCAG3’ represents
a DNA chain.