The fascinating journey of discoveries that elucidated the structure of the most important biological molecule started in the hand of F. Miescher in Germany in 1869, who isolated an acidic substance different from protein in the nucleus of pus cell and named it as ‘Nuclein’. The substance was later named as nucleic
acid by R. Altmann. Basic unit of the substance was discovered to be a nucleotide consisting of a ribose sugar joined to a nitrogenous base and a phosphate group. The nucleotides are connected to each other by a pisospliodiester bridge to develop a long polynucleotide chain. Each base is linked to the 1’ carbon of the
sugar moiety by glycosidic bond. Chemically, there are four types of nucleotides in DNA which vary from each other due to change in the nitrogenous base structure. Four types of nitrogenous bases,
Adenine, Guanine, Cytosine and Thymine are present in DNA that are sequentially arranged on 2’-deoxyribose sugar of every nucleotide. It is the sequence of these bases present in DNA that
make up the genetic information of the organism. Two of these bases, Adenine and Guanine are derivatives of purine, while Cytosine and Thymine, as well as Uracil present in RNA are derivatives of pyrimidine bases. Primary composition of DNA and RNA are essentially same, however in RNA in place of deoxyribose, ribose sugar is present and pyrimidine base Uracil is present in place of Thymine. Presence of a 2’-hydroxy group in RNA makes it more reactive and less stable than DNA, which is one of the major reasons of replacing RNA by DNA as genetic material in the course of evolution. The chain of DNA or RNA can be
extended by joining 5’-carbon of the ribose/deoxyribose sugar of nucleotide to the 3’-phosphate group of the existing chain, so that DNA/RNA chain grows only in the direction of 5’-+3”. Each of the polynucleotide chain is, therefore has a polarity as well as a net negative charge due to presence of phosphate groups.Conventional norm of representing a DNA or RNA molecule is by the base sequence present in the chain along with the direction of polarity, such as 5’AATGCGAGTCCAGGTCCCAG3’ represents
a DNA chain.